Forward and Reverse Primer design for beginners

Primers are key ingredients in DNA synthesis, a process that occurs in sequencing, cloning, PCR, and other molecular biology methods in the lab. With Benchling, teams can easily access shared primer libraries, upload new primer sequences, or design brand new primers. Link primer information directly in the Benchling Notebook and Benchling Registry providing full traceability for every experiment where a primer was used. Be able to easily attribute results from experiments with the exact set of primers used, or see which sequences a primer is associated with. Once primers are designed, run in silico PCR, or use them to plan critical tasks such as restriction cloning, Golden Gate assembly, and Gibson cloning. What are primers? Primers are simple but key ingredients for DNA synthesis both within our bodies and within scientific experiments. Primers can also be called oligonucleotides and are literally small pieces of single-stranded nucleotides, generally about 5 – 22 base pairs in length. The main property of primers is they must be complementary to the DNA template strand, serving to “prime” the strand for DNA polymerase to bind to and initiate DNA synthesis. What types of primers are there? RNA vs DNA primers Living organisms solely use RNA primers, while primers used in the lab are usually DNA primers. Scientists use DNA primers instead of RNA primers for a variety or reasons. DNA primers are far more stable and easier to store, and they require less hard-to-come-by enzymes to initiate synthesis. Problem: Design 5 nucleotide primers to copy highlighted fragment. ​​5 ́ ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGGCA 3 ́ 3 ́ TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5 ́ \