In molecular biology, a reading frame is a way of dividing the sequence of nucleotides in a nucleic acid (DNA or RNA) molecule into a set of consecutive, non-overlapping triplets. Where these triplets equate to amino acids or stop signals during translation, they are called codons.
A single strand of a nucleic acid molecule has a phosphoryl end, called the 5′-end, and a hydroxyl or 3′-end. These define the 5′→3′ direction. There are three reading frames that can be read in this 5′→3′ direction, each beginning from a different nucleotide in a triplet. In a double stranded nucleic acid, an additional three reading frames may be read from the other, complementary strand in the 5′→3′ direction along this strand. As the two strands of a double-stranded nucleic acid molecule are antiparallel, the 5′→3′ direction on the second strand corresponds to the 3′→5′ direction along the first strand.
In general, at the most, one reading frame in a given section of a nucleic acid, is biologically relevant (open reading frame). Some viral transcripts can be translated using multiple, overlapping reading frames. There is one known example of overlapping reading frames in mammalian mitochondrial DNA: coding portions of genes for 2 subunits of ATPase overlap.
DNA encodes protein sequence by a series of three-nucleotide codons. Any given sequence of DNA can therefore be read in six different ways: Three reading frames in one direction (starting at different nucleotides) and three in the opposite direction. During transcription, the RNA polymerase read the template DNA strand in the 3′→5′ direction, but the mRNA is formed in the 5′ to 3′ direction.[3] The mRNA is single-stranded and therefore only contains three possible reading frames, of which only one is translated. The codons of the mRNA reading frame are translated in the 5′→3′ direction into amino acids by a ribosome to produce a polypeptide chain.
Question:
If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode?
5’UCAGGAGGUUAUGGACCAUUGCUGGGACCUUUACAUGCUGUACCAUAGUUCAUGAUAGCCAUG3
#NikolaysGeneticsLessons #mRNA #DNA #codons #Genetics #Proteins #AminoAcids #nucleicAcids #RNA #biology #Transcription #Translation #polypeptide #enzyme #codon #Nucleotide #codonTable #aminoAcid #rybosome #Trna #anticodon #Rrna #TransferRNA #GeneticsFieldOfStudy #stopCodon #startCodon #AnticodonAndCodon #anticodonWooble #anticodonSequence #basePairs #protein #typesOfRNA #codonChart #RNAPolymerase #transcriptionVsTranslation
1 view
7
2
2 months ago 00:05:17 1
The Ultimate Email Extractor in 2024: YellowPages Scraper 🌎
2 months ago 00:03:55 1
Pokemon GO Joystick, Teleport, Auto Walk - How to Get Pokemon GO Spoofer iOS & Android 2024 FREE
2 months ago 00:12:05 1
ZenBusiness Review 2024: What Makes It Stand Out?
2 months ago 00:04:14 1
Paramore: Decode [OFFICIAL VIDEO]
2 months ago 02:01:18 1
Half-Life 2: 20th Anniversary Documentary
2 months ago 00:36:24 2
Best of the Worst Trivia!
2 months ago 00:03:07 1
Delta Executor iOS iPhone Android NO KEY - Roblox Script Executor Mobile NEW UPDATE 2024
2 months ago 00:03:04 1
Bach, Organ Sonata No. 4 in E minor (BWV 528) 3. Un poco Allegro.
2 months ago 00:04:49 1
Play To Earn🔥This New Play to Earn Game is About to Make a Lot of People RICH
2 months ago 00:03:04 1
Arena Of Valor Hack - How to Get Unlimited Vouchers! iOS Android